Review




Structured Review

Solexa solexa deep sequencing
Solexa Deep Sequencing, supplied by Solexa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/solexa+deep+sequencing/deep+sequencing+solexa/pm40806465-95-9-9
Average 86 stars, based on 1 article reviews
solexa deep sequencing - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Treatment of angiogenesis disorders
Article Snippet: Identification of Novel Genes Modulating Liver Colonization Through Whole Genome Pooled shRNA Screen To recover a complex pool of shRNA library sequences from the genomic DNA, a PCR approach followed by Solexa deep sequencing of PCR amplicons were used. .. An initial PCR amplification was performed on 500 ng of genomic DNA using primers (forward primer: 5′-TGGACTATCATATGCTTACCGTAACT-3′ (SEQ ID NO: 137); reverse primer: 5′-AAAGAGGAT CTCTGTCCCTGT-3′ (SEQ ID NO: 138)) specific for the virus vector, followed by primers with sequences required for Solexa deep sequencing (forward primer: 5′-AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTATTCTTGGCTTTATATATCT TGTGGAAAGGAC-3′ (SEQ ID NO: 139); reverse primer: 5′-CAAGCAGAAGACGGCATACG AGCTCTTCCGATCTGGATGAATACTGCCATTTGTCTCGAGGTCGA-3′ (SEQ ID NO: 140)) to obtain amplicons containing the shRNA sequences. ..

Amplification:

Article Title: Treatment of angiogenesis disorders
Article Snippet: Identification of Novel Genes Modulating Liver Colonization Through Whole Genome Pooled shRNA Screen To recover a complex pool of shRNA library sequences from the genomic DNA, a PCR approach followed by Solexa deep sequencing of PCR amplicons were used. .. An initial PCR amplification was performed on 500 ng of genomic DNA using primers (forward primer: 5′-TGGACTATCATATGCTTACCGTAACT-3′ (SEQ ID NO: 137); reverse primer: 5′-AAAGAGGAT CTCTGTCCCTGT-3′ (SEQ ID NO: 138)) specific for the virus vector, followed by primers with sequences required for Solexa deep sequencing (forward primer: 5′-AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTATTCTTGGCTTTATATATCT TGTGGAAAGGAC-3′ (SEQ ID NO: 139); reverse primer: 5′-CAAGCAGAAGACGGCATACG AGCTCTTCCGATCTGGATGAATACTGCCATTTGTCTCGAGGTCGA-3′ (SEQ ID NO: 140)) to obtain amplicons containing the shRNA sequences. ..

Virus:

Article Title: Treatment of angiogenesis disorders
Article Snippet: Identification of Novel Genes Modulating Liver Colonization Through Whole Genome Pooled shRNA Screen To recover a complex pool of shRNA library sequences from the genomic DNA, a PCR approach followed by Solexa deep sequencing of PCR amplicons were used. .. An initial PCR amplification was performed on 500 ng of genomic DNA using primers (forward primer: 5′-TGGACTATCATATGCTTACCGTAACT-3′ (SEQ ID NO: 137); reverse primer: 5′-AAAGAGGAT CTCTGTCCCTGT-3′ (SEQ ID NO: 138)) specific for the virus vector, followed by primers with sequences required for Solexa deep sequencing (forward primer: 5′-AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTATTCTTGGCTTTATATATCT TGTGGAAAGGAC-3′ (SEQ ID NO: 139); reverse primer: 5′-CAAGCAGAAGACGGCATACG AGCTCTTCCGATCTGGATGAATACTGCCATTTGTCTCGAGGTCGA-3′ (SEQ ID NO: 140)) to obtain amplicons containing the shRNA sequences. ..

Plasmid Preparation:

Article Title: Treatment of angiogenesis disorders
Article Snippet: Identification of Novel Genes Modulating Liver Colonization Through Whole Genome Pooled shRNA Screen To recover a complex pool of shRNA library sequences from the genomic DNA, a PCR approach followed by Solexa deep sequencing of PCR amplicons were used. .. An initial PCR amplification was performed on 500 ng of genomic DNA using primers (forward primer: 5′-TGGACTATCATATGCTTACCGTAACT-3′ (SEQ ID NO: 137); reverse primer: 5′-AAAGAGGAT CTCTGTCCCTGT-3′ (SEQ ID NO: 138)) specific for the virus vector, followed by primers with sequences required for Solexa deep sequencing (forward primer: 5′-AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTATTCTTGGCTTTATATATCT TGTGGAAAGGAC-3′ (SEQ ID NO: 139); reverse primer: 5′-CAAGCAGAAGACGGCATACG AGCTCTTCCGATCTGGATGAATACTGCCATTTGTCTCGAGGTCGA-3′ (SEQ ID NO: 140)) to obtain amplicons containing the shRNA sequences. ..

Sequencing:

Article Title: Treatment of angiogenesis disorders
Article Snippet: Identification of Novel Genes Modulating Liver Colonization Through Whole Genome Pooled shRNA Screen To recover a complex pool of shRNA library sequences from the genomic DNA, a PCR approach followed by Solexa deep sequencing of PCR amplicons were used. .. An initial PCR amplification was performed on 500 ng of genomic DNA using primers (forward primer: 5′-TGGACTATCATATGCTTACCGTAACT-3′ (SEQ ID NO: 137); reverse primer: 5′-AAAGAGGAT CTCTGTCCCTGT-3′ (SEQ ID NO: 138)) specific for the virus vector, followed by primers with sequences required for Solexa deep sequencing (forward primer: 5′-AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTATTCTTGGCTTTATATATCT TGTGGAAAGGAC-3′ (SEQ ID NO: 139); reverse primer: 5′-CAAGCAGAAGACGGCATACG AGCTCTTCCGATCTGGATGAATACTGCCATTTGTCTCGAGGTCGA-3′ (SEQ ID NO: 140)) to obtain amplicons containing the shRNA sequences. ..

Article Title: MicroRNA528 and Its Regulatory Roles in Monocotyledonous Plants
Article Snippet: .. In maize, the dynamic expression profiling of miRNAs by Solexa deep sequencing in Zhengdan 958, an elite maize hybrid and cultivated widely in China, revealed that the abundance of zma-miR528a and zma-miR528b decreased linearly in the grain filling stage; and eight putative target genes of zma-miR528 were identified, which could be grouped by their diverse functionalities, including oxidoreductase activity, signal transduction, development, post-translational regulation, and stress response [ ]. ..

Article Title: MicroRNA528 and Its Regulatory Roles in Monocotyledonous Plants.
Article Snippet: .. In maize, the dynamic expression profiling of miRNAs by Solexa deep sequencing in Zhengdan 958, an elite maize hybrid and cultivated widely in China, revealed that the abundance of zma-miR528a and zma-miR528b decreased linearly in the grain filling stage; and eight putative target genes of zma-miR528 were identified, which could be grouped by their diverse functionalities, including oxidoreductase activity, signal transduction, development, post-translational regulation, and stress response [17]. ..

Article Title: Identification and Characterization of the miRNA Transcriptome Controlling Green Pigmentation of Chicken Eggshells
Article Snippet: .. In this study, we used the Solexa deep sequencing approach to investigate the regulatory mechanisms behind changes in green and white eggshells from homozygous green-eggshell hens. ..

Article Title: Toward Understanding Mechanistic Regulation of Body Size and Growth Control in Bivalve Mollusks
Article Snippet: Ahmed Mokrani, Jian-an Li, Qi Li, Shikai Liu Bivalves possess a pair of valves connected to a stretchable ligament that facilitates the opening and closing of the shell.. The growth bioprocess commences when the supplemental materials secreted from the edge are added to the early-constructed shell.. Here, we endeavor to provide a glimpse into physiological responses, mechanistic control, and omics applications toward understanding this complex trait.

Article Title: Egg characteristics assessment as an enabler for in-ovo sexing technology: A review
Article Snippet: The culling of day-old male chicks remains a significant challenge for the egg-laying industry.. While in ovo sexing technology has made strides, it has yet to achieve an optimal balance between early identification of sex at hatching, high sensitivity, and non-invasive operation.. This paper aims to provide a comprehensive review of the research progress in in ovo sexing from various perspectives and to explore potential solutions in light of industrial practices and key technological bottlenecks.

Article Title: The composition of human sperm sncRNAome: a cross-country small RNA profiling.
Article Snippet: .. Lian C, Sun B, Niu S, Yang R, Liu B, Lu C, et al. A comparative profile of the microRNA transcriptome in immature and mature porcine testes using Solexa deep sequencing. ..

Article Title: The regulatory role of Epinephelus Coioides miR-21 in the Infection and Replication of Iridovirus SGIV
Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

shRNA:

Article Title: Treatment of angiogenesis disorders
Article Snippet: Identification of Novel Genes Modulating Liver Colonization Through Whole Genome Pooled shRNA Screen To recover a complex pool of shRNA library sequences from the genomic DNA, a PCR approach followed by Solexa deep sequencing of PCR amplicons were used. .. An initial PCR amplification was performed on 500 ng of genomic DNA using primers (forward primer: 5′-TGGACTATCATATGCTTACCGTAACT-3′ (SEQ ID NO: 137); reverse primer: 5′-AAAGAGGAT CTCTGTCCCTGT-3′ (SEQ ID NO: 138)) specific for the virus vector, followed by primers with sequences required for Solexa deep sequencing (forward primer: 5′-AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTATTCTTGGCTTTATATATCT TGTGGAAAGGAC-3′ (SEQ ID NO: 139); reverse primer: 5′-CAAGCAGAAGACGGCATACG AGCTCTTCCGATCTGGATGAATACTGCCATTTGTCTCGAGGTCGA-3′ (SEQ ID NO: 140)) to obtain amplicons containing the shRNA sequences. ..

Expressing:

Article Title: MicroRNA528 and Its Regulatory Roles in Monocotyledonous Plants
Article Snippet: .. In maize, the dynamic expression profiling of miRNAs by Solexa deep sequencing in Zhengdan 958, an elite maize hybrid and cultivated widely in China, revealed that the abundance of zma-miR528a and zma-miR528b decreased linearly in the grain filling stage; and eight putative target genes of zma-miR528 were identified, which could be grouped by their diverse functionalities, including oxidoreductase activity, signal transduction, development, post-translational regulation, and stress response [ ]. ..

Article Title: MicroRNA528 and Its Regulatory Roles in Monocotyledonous Plants.
Article Snippet: .. In maize, the dynamic expression profiling of miRNAs by Solexa deep sequencing in Zhengdan 958, an elite maize hybrid and cultivated widely in China, revealed that the abundance of zma-miR528a and zma-miR528b decreased linearly in the grain filling stage; and eight putative target genes of zma-miR528 were identified, which could be grouped by their diverse functionalities, including oxidoreductase activity, signal transduction, development, post-translational regulation, and stress response [17]. ..

Article Title: The regulatory role of Epinephelus Coioides miR-21 in the Infection and Replication of Iridovirus SGIV
Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Activity Assay:

Article Title: MicroRNA528 and Its Regulatory Roles in Monocotyledonous Plants
Article Snippet: .. In maize, the dynamic expression profiling of miRNAs by Solexa deep sequencing in Zhengdan 958, an elite maize hybrid and cultivated widely in China, revealed that the abundance of zma-miR528a and zma-miR528b decreased linearly in the grain filling stage; and eight putative target genes of zma-miR528 were identified, which could be grouped by their diverse functionalities, including oxidoreductase activity, signal transduction, development, post-translational regulation, and stress response [ ]. ..

Article Title: MicroRNA528 and Its Regulatory Roles in Monocotyledonous Plants.
Article Snippet: .. In maize, the dynamic expression profiling of miRNAs by Solexa deep sequencing in Zhengdan 958, an elite maize hybrid and cultivated widely in China, revealed that the abundance of zma-miR528a and zma-miR528b decreased linearly in the grain filling stage; and eight putative target genes of zma-miR528 were identified, which could be grouped by their diverse functionalities, including oxidoreductase activity, signal transduction, development, post-translational regulation, and stress response [17]. ..

Transduction:

Article Title: MicroRNA528 and Its Regulatory Roles in Monocotyledonous Plants
Article Snippet: .. In maize, the dynamic expression profiling of miRNAs by Solexa deep sequencing in Zhengdan 958, an elite maize hybrid and cultivated widely in China, revealed that the abundance of zma-miR528a and zma-miR528b decreased linearly in the grain filling stage; and eight putative target genes of zma-miR528 were identified, which could be grouped by their diverse functionalities, including oxidoreductase activity, signal transduction, development, post-translational regulation, and stress response [ ]. ..

Article Title: MicroRNA528 and Its Regulatory Roles in Monocotyledonous Plants.
Article Snippet: .. In maize, the dynamic expression profiling of miRNAs by Solexa deep sequencing in Zhengdan 958, an elite maize hybrid and cultivated widely in China, revealed that the abundance of zma-miR528a and zma-miR528b decreased linearly in the grain filling stage; and eight putative target genes of zma-miR528 were identified, which could be grouped by their diverse functionalities, including oxidoreductase activity, signal transduction, development, post-translational regulation, and stress response [17]. ..

Concentration Assay:

Article Title: Egg characteristics assessment as an enabler for in-ovo sexing technology: A review
Article Snippet: The culling of day-old male chicks remains a significant challenge for the egg-laying industry.. While in ovo sexing technology has made strides, it has yet to achieve an optimal balance between early identification of sex at hatching, high sensitivity, and non-invasive operation.. This paper aims to provide a comprehensive review of the research progress in in ovo sexing from various perspectives and to explore potential solutions in light of industrial practices and key technological bottlenecks.

Infection:

Article Title: The regulatory role of Epinephelus Coioides miR-21 in the Infection and Replication of Iridovirus SGIV
Article Snippet: This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record.. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article.. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.



Similar Products

86
Solexa solexa deep sequencing
Solexa Deep Sequencing, supplied by Solexa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/solexa+deep+sequencing/deep+sequencing+solexa/pm40806465-95-9-9
Average 86 stars, based on 1 article reviews
solexa deep sequencing - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results